pRSV-PKImut-v2
(Plasmid
#45067)
-
PurposeExpression of intactive PKI (PKA inhibitor) mutant
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSV-link
-
Backbone manufacturerMaurer lab
- Backbone size w/o insert (bp) 4265
- Total vector size (bp) 4517
-
Modifications to backboneBackbone derived from pRSV-globin
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecAMP-dependent protein kinase inhibitor alpha
-
Alt namePKI alpha
-
SpeciesSynthetic
-
Insert Size (bp)250
-
Mutationchanged Arg 20 & 21 to Glycines
-
GenBank IDM23079.1
- Promoter RSV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGATACAATAAACGCCATTTGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from RSV-PKI constructed by the Maurer lab and described in Day et al., J. Biol. Chem. 264, 431-436, 1989. Altered to add a Kozak consensus translation initiation sequence and also the ori was changed to yield high copy number in E coli.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSV-PKImut-v2 was a gift from Richard Maurer (Addgene plasmid # 45067 ; http://n2t.net/addgene:45067 ; RRID:Addgene_45067)