Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pThy1-Flpbow1
(Plasmid #45180)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45180 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18
  • Total vector size (bp) 4000
  • Vector type
    linearized for transgenic mouse injection

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pThy1-Flpbow1
  • Species
    jelly fish and coral fluorescent proteins
  • Insert Size (bp)
    4000
  • Promoter Thy1

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTGAGTGGCAAAGGACCTTAGG
  • 3′ sequencing primer GACTTGGGGAGGGAGTCAGCTGACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    cloned by Kim Cohen and Dawen Cai

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pThy1-Flpbow1 was a gift from Joshua Sanes (Addgene plasmid # 45180 ; http://n2t.net/addgene:45180 ; RRID:Addgene_45180)
  • For your References section:

    Improved tools for the Brainbow toolbox. Cai D, Cohen KB, Luo T, Lichtman JW, Sanes JR. Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5. 10.1038/nmeth.2450 PubMed 23817127