pcDNA5/FRT-HA-hM3D(Gq)
(Plasmid #45547)

• Depositing Lab: Bryan Roth
• Publication: Armbruster et al Proc Natl Acad Sci U S A. 2007 Mar 20;104(12):5163-8. Epub 2007 Mar 2.

Backbone

• Vector backbone: pcDNA5/FRT
  (Search Vector Database)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5059
• Total vector size (bp): 6832
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HA-hM3D
• Species: H. sapiens (human)
• Insert Size (bp): 1773
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: cctcgactgtgccttcta

Resource Information

• Supplemental Documents:
  • Detailed information on this plasmid from Roth lab
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry