Skip to main content
Addgene

pLKO.1-lincRNA-RorR-sh2 (Linc-sh2)
(Plasmid #45765)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45765 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone manufacturer
    Bob Weinberg
  • Backbone size w/o insert (bp) 7032
  • Total vector size (bp) 7086
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lincRNA-RoR shRNA2
  • Alt name
    Linc-sh2
  • gRNA/shRNA sequence
    lincRNA-RoR
  • Species
    H. sapiens (human)
  • Entrez Gene
    LINC-ROR (a.k.a. ROR, lincRNA-RoR, lincRNA-ST8SIA3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-lincRNA-RorR-sh2 (Linc-sh2) was a gift from George Daley (Addgene plasmid # 45765 ; http://n2t.net/addgene:45765 ; RRID:Addgene_45765)
  • For your References section:

    Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells. Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, Garber M, Curran M, Onder T, Agarwal S, Manos PD, Datta S, Lander ES, Schlaeger TM, Daley GQ, Rinn JL. Nat Genet. 2010 Dec;42(12):1113-7. Epub 2010 Nov 7. 10.1038/ng.710 PubMed 21057500