Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBEST-PLlacO-1-UTR1-deCFP-T500
(Plasmid #45777)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45777 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBEST-Luc
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    pTacI promoter was removed and replaced by PLlacO-1. Untranslated region was removed and replaced by UTR1, a powerful UTR. Luc gene (firefly Luciferase) was removed and replaced by deCFP. A transcriptional terminator was added, called T500.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    deCFP
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter PLlacO-1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATGGTGAAGACTATCGCAC
  • 3′ sequencing primer GAAGGAGCTGACTGGGTTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux, University of Minnesota

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-PLlacO-1-UTR1-deCFP-T500 was a gift from Richard Murray (Addgene plasmid # 45777 ; http://n2t.net/addgene:45777 ; RRID:Addgene_45777)