Skip to main content

pLKO.1 shRUNX1 puro
(Plasmid #45816)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45816 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Weinberg Lab (Addgene plasmid 8453)
  • Backbone size w/o insert (bp) 7032
  • Total vector size (bp) 7100
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Runx1
  • Alt name
    runt related transcription factor 1
  • Alt name
    AML1
  • Alt name
    CBFA2
  • gRNA/shRNA sequence
    CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    RUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 shRUNX1 puro was a gift from Kevin Janes (Addgene plasmid # 45816 ; http://n2t.net/addgene:45816 ; RRID:Addgene_45816)
  • For your References section:

    Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression. Wang L, Brugge JS, Janes KA. Proc Natl Acad Sci U S A. 2011 Oct 4;108(40):E803-12. doi: 10.1073/pnas.1103423108. Epub 2011 Aug 22. 10.1073/pnas.1103423108 PubMed 21873240