-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerWeinberg Lab (Addgene plasmid 8453)
- Backbone size w/o insert (bp) 7032
- Total vector size (bp) 7100
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRunx1
-
Alt namerunt related transcription factor 1
-
Alt nameAML1
-
Alt nameCBFA2
-
gRNA/shRNA sequenceCCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTT
-
SpeciesH. sapiens (human)
-
Entrez GeneRUNX1 (a.k.a. AML1, AML1-EVI-1, AMLCR1, CBF2alpha, CBFA2, EVI-1, PEBP2aB, PEBP2alpha)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 shRUNX1 puro was a gift from Kevin Janes (Addgene plasmid # 45816 ; http://n2t.net/addgene:45816 ; RRID:Addgene_45816) -
For your References section:
Intersection of FOXO- and RUNX1-mediated gene expression programs in single breast epithelial cells during morphogenesis and tumor progression. Wang L, Brugge JS, Janes KA. Proc Natl Acad Sci U S A. 2011 Oct 4;108(40):E803-12. doi: 10.1073/pnas.1103423108. Epub 2011 Aug 22. 10.1073/pnas.1103423108 PubMed 21873240