-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD/His A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4292
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegamS
-
Alt nameLambda phage Gam
-
SpeciesLambda phage
- Promoter pBAD
-
Tag
/ Fusion Protein
- Histag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAACTCTCTACTGTTTCTCCATAC
- 3′ sequencing primer GATTTAATCTGTATCAGGCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVincent Noireaux, University of Minnesota
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBADmod1-linker2-gamS was a gift from Richard Murray & Vincent Noireaux (Addgene plasmid # 45833 ; http://n2t.net/addgene:45833 ; RRID:Addgene_45833) -
For your References section:
Linear DNA for rapid prototyping of synthetic biological circuits in an Escherichia coli based TX-TL cell-free system. Sun ZZ, Yeung E, Hayes CA, Noireaux V, Murray RM. ACS Synth Biol. 2014 Jun 20;3(6):387-97. doi: 10.1021/sb400131a. Epub 2013 Dec 4. 10.1021/sb400131a PubMed 24303785