Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open and shipping orders.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBEST-OR2-OR1-Pr-UTR1-deGFP-T500
(Plasmid #40019)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40019 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBEST-Luc
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 4486
  • Modifications to backbone
    pTacI promoter was removed and replaced by the bacteriophage Lambda promoter OR2-OR1-Pr, with one mutation made in this promoter. Untranslated region was removed and relplaced by UTR1, a powerful UTR (see reference related to this plasmid) Luc gene (firefly Luciferase) was removed and replaced by deGFP. A transcriptional terminator was added, called T500 (see reference related to this plasmid).
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    KL740
  • Growth instructions
    Grow at 29C in strain KL740, LB medium.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    deGFP
  • Alt name
    eGFP-Del6-229
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter OR2-OR1-Pr (bacteriophage Lambda with one mutation)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TATACCATGGAGCTTTTCACTGGCG
  • 3′ sequencing primer CGTGACCGCCGCCGGGATCTAACTCGAGCAAAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-OR2-OR1-Pr-UTR1-deGFP-T500 was a gift from Vincent Noireaux (Addgene plasmid # 40019 ; http://n2t.net/addgene:40019 ; RRID:Addgene_40019)
  • For your References section:

    Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70. Shin J, Noireaux V. J Biol Eng. 2010 Jun 24;4:8. 10.1186/1754-1611-4-8 PubMed 20576148