Skip to main content

pSH100 (YCplac33 MET25pro MCP-mCherry)
(Plasmid #45930)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45930 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    YCplac33
  • Total vector size (bp) 6561
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCP-mCherry
  • Alt name
    MS2 coat protein
  • Insert Size (bp)
    1098
  • Promoter Met25
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATGGCACGTGAAGCTGTCG
  • 3′ sequencing primer GGCCGCAAATTAAAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH100 (YCplac33 MET25pro MCP-mCherry) was a gift from Robert Singer & Daniel Zenklusen (Addgene plasmid # 45930 ; http://n2t.net/addgene:45930 ; RRID:Addgene_45930)
  • For your References section:

    Single-molecule analysis of gene expression using two-color RNA labeling in live yeast. Hocine S, Raymond P, Zenklusen D, Chao JA, Singer RH. Nat Methods. 2013 Feb;10(2):119-21. doi: 10.1038/nmeth.2305. Epub 2012 Dec 23. 10.1038/nmeth.2305 PubMed 23263691