-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45931 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHIS
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCP-PS
-
Alt namePP7 coat protein
-
Insert Size (bp)1833
- Promoter Met25
-
Tag
/ Fusion Protein
- 2x-yeGFP (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATGGCACGTGAAGCTGTCG
- 3′ sequencing primer GGCCGCAAATTAAAGCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDZ513 (pHIS MET25pro PP7-PS-yeGFP) was a gift from Daniel Zenklusen (Addgene plasmid # 45931 ; http://n2t.net/addgene:45931 ; RRID:Addgene_45931) -
For your References section:
Single-molecule analysis of gene expression using two-color RNA labeling in live yeast. Hocine S, Raymond P, Zenklusen D, Chao JA, Singer RH. Nat Methods. 2013 Feb;10(2):119-21. doi: 10.1038/nmeth.2305. Epub 2012 Dec 23. 10.1038/nmeth.2305 PubMed 23263691