Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTD-C_eYFPTwinStrep
(Plasmid #45942)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45942 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTD-CTwinStrep
  • Backbone manufacturer
    Dammeyer et al. 2013
  • Modifications to backbone
    cloning of synthetic eYFP insert into EcoRI and XbaI sites of pTD-CTwinStrep for C-terminal fusion to TwinStrep-tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For growth in P.putida KT2440 (30C); on plates use spectinomycin in addition.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    synthetic eYFP (codon usage adapted to E.coli K12)
  • Species
    Aequorea victoria
  • Promoter lacIq/Ptrc
  • Tag / Fusion Protein
    • Twin-Strep-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TGTGTGGAATTGTGAGCGG
  • 3′ sequencing primer ACTTTGTTTTAGGGCGACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates.

The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTD-C_eYFPTwinStrep was a gift from Thorben Dammeyer (Addgene plasmid # 45942 ; http://n2t.net/addgene:45942 ; RRID:Addgene_45942)
  • For your References section:

    Broad host range vectors for expression of proteins with (Twin-) Strep-tag, His-tag and engineered, export optimized yellow fluorescent protein. Dammeyer T, Timmis KN, Tinnefeld P. Microb Cell Fact. 2013 May 20;12(1):49. 10.1186/1475-2859-12-49 PubMed 23687945