pQUASp-mCD8GFP
(Plasmid
#46163)
-
PurposeExpression of murine CD8GFP in insects
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQUASp
- Backbone size w/o insert (bp) 9896
- Total vector size (bp) 11285
-
Vector typeInsect Expression
-
Selectable markerswhite
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCD8GFP
-
Alt namemouseCD8
-
Alt nameGFP
-
Alt nameCD8
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)1389
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TTTGAAAACCGGTGATAGAGCCTG
- 3′ sequencing primer ACCAGGGGATGCTTAATTGTGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQUASp-mCD8GFP was a gift from Christopher Potter (Addgene plasmid # 46163 ; http://n2t.net/addgene:46163 ; RRID:Addgene_46163) -
For your References section:
Organization of olfactory centres in the malaria mosquito Anopheles gambiae. Riabinina O, Task D, Marr E, Lin CC, Alford R, O'Brochta DA, Potter CJ. Nat Commun. 2016 Oct 3;7:13010. doi: 10.1038/ncomms13010. 10.1038/ncomms13010 PubMed 27694947