Skip to main content
Addgene

pMA3379
(Plasmid #46874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMA3211
  • Backbone manufacturer
    Homemade
  • Backbone size w/o insert (bp) 6642
  • Total vector size (bp) 8766
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    soluble guanylate cyclase 1alpha3
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2184
  • Entrez Gene
    Gucy1a3 (a.k.a. Gucy1a1, SGC)
  • Promoter TRE-Tight
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (destroyed during cloning)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer ctatagtgaatagagttagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA was purchased from Open Biosystems

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that though there are some differences between Addgene's quality control sequence and the depositor's assembled sequence, this plasmid should function as reported.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA3379 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46874 ; http://n2t.net/addgene:46874 ; RRID:Addgene_46874)
  • For your References section:

    Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478