-
PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1 promoter
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAH057
- Backbone size w/o insert (bp) 5083
- Total vector size (bp) 5202
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgTEF1 promoter
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)119
-
Entrez GeneTEF1 (a.k.a. YPR080W)
- Promoter SNR52
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcgattaagttgggtaacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence TTGATATTTAAGTTAATAAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSNR52-sgTEF1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46922 ; http://n2t.net/addgene:46922 ; RRID:Addgene_46922) -
For your References section:
CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981