Skip to main content

5HRE/GFP
(Plasmid #46926)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46926 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 46926-D50 50 μg of DNA in Tris buffer $495
DNA 46926-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEF/myc/cyto
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    5X HRE of VEGF
  • Alt name
    VEGFA
  • Alt name
    VEGF
  • Species
    H. sapiens (human)
  • Mutation
    five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter EF-1α promoter
  • Tag / Fusion Protein
    • d2EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer EF1a-F
  • 3′ sequencing primer BGHrev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT

The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5HRE/GFP was a gift from Martin Brown & Thomas Foster (Addgene plasmid # 46926 ; http://n2t.net/addgene:46926 ; RRID:Addgene_46926)
  • For your References section:

    Green fluorescent protein is a suitable reporter of tumor hypoxia despite an oxygen requirement for chromophore formation. Vordermark D, Shibata T, Brown JM. Neoplasia. 2001 Nov-Dec;3(6):527-34. 10.1038/sj/neo/7900192 PubMed 11774035