-
PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoRI;1.4kb),can be replaced w mir30 based hairpin of interest
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGIPZ
-
Backbone manufacturerOpen Biosystems
- Backbone size w/o insert (bp) 11688
- Total vector size (bp) 14699
-
Modifications to backbonepINDUCER12 (miR-RUL) was made by digesting pINDUCER10 with XbaI and PacI. The IRES was isolated from the same vector by digesting with XbaI and NcoI. Luciferase was PCR amplified from pEF1-Luc-IRES-neo using primers 5′- TACTACCGGTCGCCACCATGGAAGACGCCAAAAACATAAA and 5′-TAGAGATTAGGATTAGGATCTTAATTAAGCGGCCGCTTACACGGCGATCTTTCCGCC. The PCR product was then digested with NcoI and PacI, ligated to the vector and IRES, and sequence verified.
-
Vector typeLentiviral
-
Selectable markersLuciferase ; tRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePheS Gly294
-
SpeciesP. haloplanktis
-
Insert Size (bp)1400
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDUCER12 (miR-RUL) was a gift from Thomas Westbrook (Addgene plasmid # 46935 ; http://n2t.net/addgene:46935 ; RRID:Addgene_46935) -
For your References section:
The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Meerbrey KL, Hu G, Kessler JD, Roarty K, Li MZ, Fang JE, Herschkowitz JI, Burrows AE, Ciccia A, Sun T, Schmitt EM, Bernardi RJ, Fu X, Bland CS, Cooper TA, Schiff R, Rosen JM, Westbrook TF, Elledge SJ. Proc Natl Acad Sci U S A. 2011 Mar 1;108(9):3665-70. doi: 10.1073/pnas.1019736108. Epub 2011 Feb 9. 10.1073/pnas.1019736108 PubMed 21307310