Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pINDUCER12 (miR-RUL)
(Plasmid #46935)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46935 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    GIPZ
  • Backbone manufacturer
    Open Biosystems
  • Backbone size w/o insert (bp) 11688
  • Total vector size (bp) 14699
  • Modifications to backbone
    pINDUCER12 (miR-RUL) was made by digesting pINDUCER10 with XbaI and PacI. The IRES was isolated from the same vector by digesting with XbaI and NcoI. Luciferase was PCR amplified from pEF1-Luc-IRES-neo using primers 5′- TACTACCGGTCGCCACCATGGAAGACGCCAAAAACATAAA and 5′-TAGAGATTAGGATTAGGATCTTAATTAAGCGGCCGCTTACACGGCGATCTTTCCGCC. The PCR product was then digested with NcoI and PacI, ligated to the vector and IRES, and sequence verified.
  • Vector type
    Lentiviral
  • Selectable markers
    Luciferase ; tRFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PheS Gly294
  • Species
    P. haloplanktis
  • Insert Size (bp)
    1400

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER12 (miR-RUL) was a gift from Thomas Westbrook (Addgene plasmid # 46935 ; http://n2t.net/addgene:46935 ; RRID:Addgene_46935)
  • For your References section:

    The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Meerbrey KL, Hu G, Kessler JD, Roarty K, Li MZ, Fang JE, Herschkowitz JI, Burrows AE, Ciccia A, Sun T, Schmitt EM, Bernardi RJ, Fu X, Bland CS, Cooper TA, Schiff R, Rosen JM, Westbrook TF, Elledge SJ. Proc Natl Acad Sci U S A. 2011 Mar 1;108(9):3665-70. doi: 10.1073/pnas.1019736108. Epub 2011 Feb 9. 10.1073/pnas.1019736108 PubMed 21307310