Skip to main content

pICE-EGFP-FLAG-Ku70siR-WT
(Plasmid #46961)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46961 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICE
  • Backbone size w/o insert (bp) 5044
  • Total vector size (bp) 7570
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Ku70
  • Alt name
    XRCC6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1830
  • GenBank ID
    NM_001469.3
  • Entrez Gene
    XRCC6 (a.k.a. CTC75, CTCBF, G22P1, KU70, ML8, TLAA)
  • Promoter CMV Tet
  • Tag / Fusion Protein
    • GFP-FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GTAGGCGTGTACGGTGGGAGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICE-EGFP-FLAG-Ku70siR-WT was a gift from Steve Jackson (Addgene plasmid # 46961 ; http://n2t.net/addgene:46961 ; RRID:Addgene_46961)
  • For your References section:

    A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892