-
PurposeExpesses the human codon usage Cas9 nuclease (Mali et al. Science 339, 823-826, 2013) with an N-terminal GFP tag from the 35S promoter in the plant tissue
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepK7WGF2
- Backbone size w/o insert (bp) 10257
- Total vector size (bp) 14397
-
Vector typeCRISPR ; Plant expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehCas9
-
SpeciesSynthetic
-
Insert Size (bp)4140
- Promoter 35S
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGGCTCCGCGGCCGC
- 3′ sequencing primer TTGTACAAGAAAGCTGGGTCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene Plasmid 41815: hCas9
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK7WGF2::hCas9 was a gift from Sophien Kamoun (Addgene plasmid # 46965 ; http://n2t.net/addgene:46965 ; RRID:Addgene_46965) -
For your References section:
Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340