Skip to main content
Addgene

pUC gRNA Shuttle
(Plasmid #47024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47024 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2691
  • Total vector size (bp) 3142
  • Modifications to backbone
    The original pUC19 MCS modified to include I-PpoI recognition site. Some restriction sites removed.
  • Vector type
    Plant Expression, CRISPR ; Cas9

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA Shuttle
  • Species
    Synthetic; Medicago truncatula
  • Insert Size (bp)
    465
  • Mutation
    G to T cloning mutation at position 323
  • Promoter Medicago truncatula U6.6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site I-PpoI (not destroyed)
  • 3′ cloning site I-PpoI (not destroyed)
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGGA
  • 3′ sequencing primer GTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC gRNA Shuttle was a gift from Wayne Parrott (Addgene plasmid # 47024 ; http://n2t.net/addgene:47024 ; RRID:Addgene_47024)
  • For your References section:

    Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnol. 2015 Mar 12;15:16. doi: 10.1186/s12896-015-0131-2. 10.1186/s12896-015-0131-2 PubMed 25879861