5HT6-CFP-Venus(H148G)
(Plasmid
#47501)
-
PurposeFluorescent reporter for pH inside primary cilia
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6700
-
Modifications to backboneDNA encoding 5HT6 flanked by NheI and AgeI was amplified by PCR from 5HT6-GFP and then subcloned into pECFP vector (Clontech).
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVenus(H148G)
-
SpeciesSynthetic
-
Insert Size (bp)720
-
MutationH148G mutation
-
Tags
/ Fusion Proteins
- 5HT6 (N terminal on backbone)
- CFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer None
- 3′ sequencing primer CCTCTACAAATGTGGTATGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5HT6-CFP-Venus(H148G) was a gift from Takanari Inoue (Addgene plasmid # 47501 ; http://n2t.net/addgene:47501 ; RRID:Addgene_47501) -
For your References section:
Genetically encoded calcium indicator illuminates calcium dynamics in primary cilia. Su S, Phua SC, Derose R, Chiba S, Narita K, Kalugin PN, Katada T, Kontani K, Takeda S, Inoue T. Nat Methods. 2013 Sep 22. doi: 10.1038/nmeth.2647. 10.1038/nmeth.2647 PubMed 24056873