5HT6-GCaMP5G
(Plasmid
#48340)
-
PurposeFluorescent reporter for Ca2+ inside primary cilia
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCustomized
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7350
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP5G
-
SpeciesSynthetic
-
Insert Size (bp)1350
-
GenBank ID
-
Tag
/ Fusion Protein
- 5HT6 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cta ctg gga tcc agt gct ggt ggt agc gca gga gga ATGGGTTCTCATCATCATCATCATCATGG
- 3′ sequencing primer CCTCTACAAATGTGGTATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
5HT6-GCaMP5G was a gift from Takanari Inoue (Addgene plasmid # 48340 ; http://n2t.net/addgene:48340 ; RRID:Addgene_48340) -
For your References section:
Genetically encoded calcium indicator illuminates calcium dynamics in primary cilia. Su S, Phua SC, Derose R, Chiba S, Narita K, Kalugin PN, Katada T, Kontani K, Takeda S, Inoue T. Nat Methods. 2013 Sep 22. doi: 10.1038/nmeth.2647. 10.1038/nmeth.2647 PubMed 24056873