-
PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCFJ601
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 8113
-
Modifications to backboneGenerated from pCFJ601 by replacing the Mos1 transposase with Cas9, then inserting the U6 Promoter::sgRNA gene. Cloning method was Gibson assembly (selected "Ligation Independent Cloning" as a generic description).
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesSynthetic
-
Insert Size (bp)4323
-
MutationCodon optimized and with synthetic introns for C. elegans
- Promoter eef-1A.1 (eft-3)
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- HA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
- 3′ sequencing primer gcttgaaaggattttgcatttatc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEmpty sgRNA
-
Insert Size (bp)81
-
MutationMissing a 19 bp targeting sequence that must be inserted before use to "program" Cas9
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer ggtgtgaaataccgcacaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byThe vector backbone, pCFJ601, was received from Addgene. The insert was synthesized in our lab.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ; http://n2t.net/addgene:47549 ; RRID:Addgene_47549) -
For your References section:
Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. 10.1038/nmeth.2641 PubMed 23995389