nes714tk/lacZ
(Plasmid #47614)

• Purpose: used to create transgenic mice expressing LacZ reporter with Nestin enhancer
• Depositing Lab: Urban Lendahl
• Publication: Lothian et al Eur J Neurosci. 1997 Mar;9(3):452-62.

Backbone

• Vector backbone: SaStk/lacZ
• Backbone manufacturer: Clontech; modified by Lendahl lab
• Modifications to backbone: removed SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
• Vector type: enhancer reporter

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nestin 2nd intron fragment
• Alt name: NES
• Species: H. sapiens (human)
• Insert Size (bp): 714
• Mutation: 714 bp from 3' end of 2nd intron
• Entrez Gene: NES (a.k.a. Nbla00170)
• Promoter: HSV tk promoter
• Tags / Fusion Proteins:
  • HSV tk promoter (C terminal on backbone)
  • lacZ (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: SaStk/lacZ 5 (gtcggggctggcttaactat)
• 3′ sequencing primer: LacZ-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.