pAC-EsaR-EsaI
(Plasmid
#47660)
-
PurposeesaI gene downstream of esaR in pAC-EsaR (CmR)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAC-EsaR
- Backbone size w/o insert (bp) 4511
- Total vector size (bp) 5332
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameesaI-term
-
Insert Size (bp)821
-
GenBank ID
- Promoter Plac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer tattacgctgatgtccggcctgc
- 3′ sequencing primer gttgaaggctctcaagggcatcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA DNA fragment containing a ribosome binding site, codon-optimized esaI, and transcriptional terminator was commercially synthesized and cloned downstream of esaR between BamHI and SalI sites in pAC-EsaR.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
esaI is 636 bp and indicated as lowercase letters in the partial sequence (between BamHI and XhoI sites). See pAC-EsaR for lac promoter and esaR sequence information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC-EsaR-EsaI was a gift from Cynthia Collins (Addgene plasmid # 47660 ; http://n2t.net/addgene:47660 ; RRID:Addgene_47660) -
For your References section:
Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176
Map uploaded by the depositor.
