pGEXndoE(E662Q)
(Plasmid
#47716)
-
PurposeExpresses GST-EndoE(E662Q) from E. faecalis in E. coli
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-5X-3
-
Backbone manufacturerGE Helthcare
- Backbone size w/o insert (bp) 4974
- Total vector size (bp) 7306
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namendoE
-
Alt namendoE
-
SpeciesEntercoccus faecalis
-
Insert Size (bp)2350
-
MutationChanged Glu-662 to Gln
-
GenBank IDAY376354
- Promoter tac
-
Tags
/ Fusion Proteins
- Glutathione S-transferase (N terminal on backbone)
- GST-EndoE(E186Q) (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEXndoE(E662Q) was a gift from Mattias Collin & Vincent Fischetti (Addgene plasmid # 47716 ; http://n2t.net/addgene:47716 ; RRID:Addgene_47716) -
For your References section:
A novel secreted endoglycosidase from Enterococcus faecalis with activity on human immunoglobulin G and ribonuclease B. Collin M, Fischetti VA. J Biol Chem. 2004 May 21;279(21):22558-70. Epub 2004 Mar 17. 10.1074/jbc.M402156200 PubMed 15028731