Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEXndoE(E662Q)
(Plasmid #47716)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47716 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-5X-3
  • Backbone manufacturer
    GE Helthcare
  • Backbone size w/o insert (bp) 4974
  • Total vector size (bp) 7306
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ndoE
  • Alt name
    ndoE
  • Species
    Entercoccus faecalis
  • Insert Size (bp)
    2350
  • Mutation
    Changed Glu-662 to Gln
  • GenBank ID
    AY376354
  • Promoter tac
  • Tags / Fusion Proteins
    • Glutathione S-transferase (N terminal on backbone)
    • GST-EndoE(E186Q) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEXndoE(E662Q) was a gift from Mattias Collin & Vincent Fischetti (Addgene plasmid # 47716 ; http://n2t.net/addgene:47716 ; RRID:Addgene_47716)
  • For your References section:

    A novel secreted endoglycosidase from Enterococcus faecalis with activity on human immunoglobulin G and ribonuclease B. Collin M, Fischetti VA. J Biol Chem. 2004 May 21;279(21):22558-70. Epub 2004 Mar 17. 10.1074/jbc.M402156200 PubMed 15028731