Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CS2-Myc-hASUN
(Plasmid #47955)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47955 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CS2
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 7100
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Asunder
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2100
  • Entrez Gene
    INTS13 (a.k.a. ASUN, C12orf11, GCT1, Mat89Bb, NET48, SPATA30)
  • Promoter Sp6
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atgaagattttttctgaatct
  • 3′ sequencing primer ggaaaagccagcc ggcagtga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CS2-Myc-hASUN was a gift from Laura Lee (Addgene plasmid # 47955 ; http://n2t.net/addgene:47955 ; RRID:Addgene_47955)
  • For your References section:

    Nuclear-localized Asunder regulates cytoplasmic dynein localization via its role in the Integrator complex. Jodoin JN, Sitaram P, Albrecht TR, May SB, Shboul M, Lee E, Reversade B, Wagner EJ, Lee LA. Mol Biol Cell. 2013 Jul 31. 10.1091/mbc.E13-05-0254 PubMed 23904267