-
PurposedCas9VP160-2A-neo (neo/G418-selectable) on pmax expression vector. Note: This is being tested.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmax-DEST (Addgene: 48222)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
-
Alt namedCas9VP160-2A-neo
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)5528
-
MutationD10A;H840A (catalytically inactive)
- Promoter CAGGS
-
Tags
/ Fusion Proteins
- HA Tag (N terminal on insert)
- VP160 (C terminal on insert)
- 2A-neo (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer gggcttgtcgagacagagaagat
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information including protocols and
updates, please go to http://www.crispr-on.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC95-pmax-dCas9VP160-2A-neo was a gift from Rudolf Jaenisch (Addgene plasmid # 48227 ; http://n2t.net/addgene:48227 ; RRID:Addgene_48227) -
For your References section:
Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020