Skip to main content

pLenti-CamkII-MacQ-mOrange2
(Plasmid #48761)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48761 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10866
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    macQ-mOrange
  • Species
    L. maculans
  • Insert Size (bp)
    1626
  • Mutation
    mac-D139Q
  • Promoter CamKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctgacgaaggctcgcgaggc
  • 3′ sequencing primer gccatacgggaagcaatagcatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: the full sequence does not include the noted mac-D139Q mutation. This mutation was confirmed in the Addgene QC sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CamkII-MacQ-mOrange2 was a gift from Mark Schnitzer (Addgene plasmid # 48761 ; http://n2t.net/addgene:48761 ; RRID:Addgene_48761)
  • For your References section:

    Imaging neural spiking in brain tissue using FRET-opsin protein voltage sensors. Gong Y, Wagner MJ, Zhong Li J, Schnitzer MJ. Nat Commun. 2014 Apr 22;5:3674. doi: 10.1038/ncomms4674. 10.1038/ncomms4674 PubMed 24755708