pTriEx4-H6-FGB
              
              
                (Plasmid
                
                #49203)
              
            
            
            
          - 
            PurposeFluorescent reporter for cGMP
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepTriEx4
- 
              Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 6768
- 
              Modifications to backbonePshA I site was used at 5' direction for inserting the insert into vector. This site was lost after ligation.
- 
              Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameH6-FGB
- 
                  Alt nameCR4Ex
- 
                    SpeciesB. taurus (bovine); GFP
- 
                  Insert Size (bp)1764
- 
                  MutationNone
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - His tag + Other tags (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PshA I (destroyed during cloning)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCGGAGTTAATCCGGGACCT
- 3′ sequencing primer None (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byProf. Wolfgang Dostmann at University of Vermont, USA.
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pTriEx4-H6-FGB was a gift from John Garthwaite (Addgene plasmid # 49203 ; http://n2t.net/addgene:49203 ; RRID:Addgene_49203)
- 
                For your References section: Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging. Bhargava Y, Hampden-Smith K, Chachlaki K, Wood KC, Vernon J, Allerston CK, Batchelor AM, Garthwaite J. Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026. 10.3389/fnmol.2013.00026 PubMed 24068983
 
    
 
                         
                         
             
             
             
             
          