Skip to main content

pMSCV-mCherry-Syk
(Plasmid #50045)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50045 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 10000
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Spleen tyrosine kinase (Syk)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3000
  • Entrez Gene
    Syk (a.k.a. Sykb)
  • Promoter pCMV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCTTCAAGGTGCACATGGAG
  • 3′ sequencing primer CACGATGGTGTAGTCCTCGTTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-mCherry-Syk was a gift from Hidde Ploegh (Addgene plasmid # 50045 ; http://n2t.net/addgene:50045 ; RRID:Addgene_50045)
  • For your References section:

    Bruton's Tyrosine Kinase (BTK) and Vav1 contribute to Dectin1-dependent phagocytosis of Candida albicans in macrophages. Strijbis K, Tafesse FG, Fairn GD, Witte MD, Dougan SK, Watson N, Spooner E, Esteban A, Vyas VK, Fink GR, Grinstein S, Ploegh HL. PLoS Pathog. 2013 Jun;9(6):e1003446. doi: 10.1371/journal.ppat.1003446. Epub 2013 Jun 27. 10.1371/journal.ppat.1003446 PubMed 23825946