Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #50606)


Item Catalog # Description Quantity Price (USD)
Plasmid 50606 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter lacUV5

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer TGTGGAATTGTGAGCGGATA
  • 3′ sequencing primer TAATGCGGTCAATTCAGCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter lacUV5

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer TGTGGAATTGTGAGCGGATA
  • 3′ sequencing primer ATCGACGATGCAGCCGAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter lacUV5

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer TGTGGAATTGTGAGCGGATA
  • 3′ sequencing primer CCTGACGCCAGAAGCATT
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter lacUV5

Cloning Information for Gene/Insert 4

  • Cloning method Unknown
  • 5′ sequencing primer TGTGGAATTGTGAGCGGATA
  • 3′ sequencing primer GTTAAGCGAATCGGCAAGG
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter lacUV5

Cloning Information for Gene/Insert 5

  • Cloning method Unknown
  • 5′ sequencing primer TGTGGAATTGTGAGCGGATA
  • 3′ sequencing primer TTTGAGCGTCAGATTTCGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pY3 was a gift from Jay Keasling (Addgene plasmid # 50606 ; ; RRID:Addgene_50606)
  • For your References section:

    Modular engineering of L-tyrosine production in Escherichia coli. Juminaga D, Baidoo EE, Redding-Johanson AM, Batth TS, Burd H, Mukhopadhyay A, Petzold CJ, Keasling JD. Appl Environ Microbiol. 2012 Jan;78(1):89-98. doi: 10.1128/AEM.06017-11. Epub 2011 Oct 21. 10.1128/AEM.06017-11 PubMed 22020510