Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pS3
(Plasmid #50596)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50596 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBbB5c
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    aroE
  • Insert Size (bp)
    810
  • Promoter lacUV5

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer TAATGATCAGCCCACTGACG
  • 3′ sequencing primer CATGGATGGCCTCCTTTAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    aroD
  • Insert Size (bp)
    758
  • Promoter lacUV5

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer TAATGATCAGCCCACTGACG
  • 3′ sequencing primer AGAGTAACGACAATACGCTCCA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    aroB
  • Insert Size (bp)
    1088
  • Promoter lacUV5

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer TAATGATCAGCCCACTGACG
  • 3′ sequencing primer GTATTCGCGGCATTTTCAGT
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    aroG*
  • Insert Size (bp)
    1052
  • Promoter lacUV5

Cloning Information for Gene/Insert 4

  • Cloning method Unknown
  • 5′ sequencing primer TAATGATCAGCCCACTGACG
  • 3′ sequencing primer CCGTTTTATCCAGCAGTTCA
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    ppsA
  • Insert Size (bp)
    2378
  • Promoter lacUV5

Cloning Information for Gene/Insert 5

Gene/Insert 6

  • Gene/Insert name
    tktA
  • Insert Size (bp)
    1991
  • Promoter lacUV5

Cloning Information for Gene/Insert 6

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. No major features or ORFs are disrupted.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS3 was a gift from Jay Keasling (Addgene plasmid # 50596 ; http://n2t.net/addgene:50596 ; RRID:Addgene_50596)
  • For your References section:

    Modular engineering of L-tyrosine production in Escherichia coli. Juminaga D, Baidoo EE, Redding-Johanson AM, Batth TS, Burd H, Mukhopadhyay A, Petzold CJ, Keasling JD. Appl Environ Microbiol. 2012 Jan;78(1):89-98. doi: 10.1128/AEM.06017-11. Epub 2011 Oct 21. 10.1128/AEM.06017-11 PubMed 22020510