Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHAGE EF1α dCas9-VP64
(Plasmid #50918)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50918 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE
  • Total vector size (bp) 12806
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4406
  • Mutation
    D10A, H840A
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • 3xHA (C terminal on insert)
    • VP64 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGAGCTCGTTTAGTGAACCG
  • 3′ sequencing primer MSCV-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE EF1α dCas9-VP64 was a gift from Rene Maehr & Scot Wolfe (Addgene plasmid # 50918 ; http://n2t.net/addgene:50918 ; RRID:Addgene_50918)
  • For your References section:

    Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. 10.1242/dev.103341 PubMed 24346702