Skip to main content

pLKO.1-puro U6 sgRNA BfuAI stuffer
(Plasmid #50920)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50920 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size (bp) 7145
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.

Please note that for improved cassette cloning efficiency the wolf lab recommends plasmid 52628.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro U6 sgRNA BfuAI stuffer was a gift from Rene Maehr & Scot Wolfe (Addgene plasmid # 50920 ; http://n2t.net/addgene:50920 ; RRID:Addgene_50920)
  • For your References section:

    Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. 10.1242/dev.103341 PubMed 24346702