Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLKO.1-puro U6 sgRNA SOX17 -126
(Plasmid #50924)


Item Catalog # Description Quantity Price (USD)
Plasmid 50924 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7145
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Sox17 -126 sgRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SOX17 (a.k.a. VUR3)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuAI (destroyed during cloning)
  • 3′ cloning site BfuAI (destroyed during cloning)
  • 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
  • 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro U6 sgRNA SOX17 -126 was a gift from Rene Maehr & Scot Wolfe (Addgene plasmid # 50924 ; ; RRID:Addgene_50924)
  • For your References section:

    Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. 10.1242/dev.103341 PubMed 24346702