-
PurposeExpress Eukaryotic-codon-optimized Cas9c gene in yeast under ADH1 promoter for genome editing. SV40 NLS is fused to the C terminal. GAL4 region from pACT2 is removed.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACT2
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 8117
- Total vector size (bp) 11495
-
Modifications to backboneSequences between the two HindIII sites are replaced by Cas9c. The GAL4 activation domain in the original vector was removed.
-
Vector typeBacterial Expression, Yeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9c
-
Alt nameCas9
-
Alt namehCas9
-
Alt namehCas9c
-
SpeciesSynthetic
-
Insert Size (bp)4140
- Promoter yeast ADH1 promoter
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCGTCATTGTTCTCGTTCC
- 3′ sequencing primer ACGTATCTACCAACGATTTGACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLuhan Yang from George M. Church Laboratory in Harvard Medical School.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACT2-CAS9c was a gift from Yunde Zhao (Addgene plasmid # 51055 ; http://n2t.net/addgene:51055 ; RRID:Addgene_51055) -
For your References section:
Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. Gao Y, Zhao Y. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. 10.1111/jipb.12152 PubMed 24373158