Arch(D95H)-eGFP
(Plasmid
#51081)
-
PurposeExpresses Arch(D95H)-eGFP in mammalian cells as a fluorescent reporter of membrane voltage
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW (from Addgene plasmid 22051)
-
Backbone manufacturerAddgene plasmid 22051
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 10700
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
-
Alt nameArch(D95H)-eGFP
-
SpeciesHalorubrum sodomense
-
Insert Size (bp)1500
-
MutationChanged Aspartic Acid 95 to Histidine
-
GenBank IDBAA09452.1
- Promoter Ubiquitin
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ttgaactatgcgctcggggttg
- 3′ sequencing primer cggtgaacagctcctcgcccttg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe received this gene (Archaerhodopsin-3) from the Boyden Lab at MIT; we made the D95H point mutation in Archaerhodopsin-3. This gene was inserted into Addgene plasmid 22051 cut with BamHI and AgeI.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid was also described in Hou et al 2014 (PMID: 24507604) and Venkatachalam et al 2014 (PMID: 24428326).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Arch(D95H)-eGFP was a gift from Adam Cohen (Addgene plasmid # 51081 ; http://n2t.net/addgene:51081 ; RRID:Addgene_51081) -
For your References section:
Screening fluorescent voltage indicators with spontaneously spiking HEK cells. Park J, Werley CA, Venkatachalam V, Kralj JM, Dib-Hajj SD, Waxman SG, Cohen AE. PLoS One. 2013 Dec 31;8(12):e85221. doi: 10.1371/journal.pone.0085221. eCollection 2013. 10.1371/journal.pone.0085221 PubMed 24391999