Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Arch(D95H)-eGFP
(Plasmid #51081)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51081 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUGW (from Addgene plasmid 22051)
  • Backbone manufacturer
    Addgene plasmid 22051
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 10700
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Archaerhodopsin-3 w/ D95H point mutation fused to eGFP
  • Alt name
    Arch(D95H)-eGFP
  • Species
    Halorubrum sodomense
  • Insert Size (bp)
    1500
  • Mutation
    Changed Aspartic Acid 95 to Histidine
  • GenBank ID
    BAA09452.1
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ttgaactatgcgctcggggttg
  • 3′ sequencing primer cggtgaacagctcctcgcccttg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received this gene (Archaerhodopsin-3) from the Boyden Lab at MIT; we made the D95H point mutation in Archaerhodopsin-3. This gene was inserted into Addgene plasmid 22051 cut with BamHI and AgeI.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid was also described in Hou et al 2014 (PMID: 24507604) and Venkatachalam et al 2014 (PMID: 24428326).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Arch(D95H)-eGFP was a gift from Adam Cohen (Addgene plasmid # 51081 ; http://n2t.net/addgene:51081 ; RRID:Addgene_51081)
  • For your References section:

    Screening fluorescent voltage indicators with spontaneously spiking HEK cells. Park J, Werley CA, Venkatachalam V, Kralj JM, Dib-Hajj SD, Waxman SG, Cohen AE. PLoS One. 2013 Dec 31;8(12):e85221. doi: 10.1371/journal.pone.0085221. eCollection 2013. 10.1371/journal.pone.0085221 PubMed 24391999