Skip to main content
Addgene

AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato
(Plasmid #51087)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51087 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CaMKIIa-WPRE-BGHpA
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 5095
  • Total vector size (bp) 7255
  • Modifications to backbone
    Altered cloning sites and replaced HGHpA with smaller BGHpA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Alt name
    G6f
  • Alt name
    GCaMP6 fast
  • Species
    Synthetic
  • Insert Size (bp)
    2160
  • Promoter CaMKIIa 1.3 kb
  • Tag / Fusion Protein
    • P2A-nls-dTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ttctccgtttgcactcaggagc
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GCaMP6f portion was derived from Addgene plasmid #40755 (Douglas Kim, Janelia Farms).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.

Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51087 ; http://n2t.net/addgene:51087 ; RRID:Addgene_51087)