Skip to main content

Thy1.2-Roxed-Cre
(Plasmid #51276)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51276 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTS(2)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Roxed-Cre
  • Promoter Thy1.2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer GAATCCAAGTCGGAACTCTTGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Based on Thy1 promoter construct (https://www.addgene.org/20736/)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1.2-Roxed-Cre was a gift from Pawel Pelczar (Addgene plasmid # 51276 ; http://n2t.net/addgene:51276 ; RRID:Addgene_51276)
  • For your References section:

    Binary recombinase systems for high-resolution conditional mutagenesis. Hermann M, Stillhard P, Wildner H, Seruggia D, Kapp V, Sanchez-Iranzo H, Mercader N, Montoliu L, Zeilhofer HU, Pelczar P. Nucleic Acids Res. 2014 Jan 9. 10.1093/nar/gkt1361 PubMed 24413561