TALEN-CCR5L18-CtermQ7
(Plasmid
#51442)
-
PurposeExpresses TALEN targeting left CCR5A site (L18) with Q7 C-terminal domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneJDS70
-
Backbone manufacturerJoung lab
- Backbone size w/o insert (bp) 5055
- Total vector size (bp) 8058
-
Modifications to backboneTAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: EL
-
Vector typeMammalian Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN CCR5 Left (L18) Q7 C-term
-
SpeciesSynthetic
-
Insert Size (bp)3003
-
MutationK777Q, K778Q, K788Q, R789Q, R792Q, R793Q and R801Q
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- Fok1 EL variant (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer GCTGATCAGCGGGTTTAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TALEN-CCR5L18-CtermQ7 was a gift from David Liu (Addgene plasmid # 51442 ; http://n2t.net/addgene:51442 ; RRID:Addgene_51442) -
For your References section:
Broad specificity profiling of TALENs results in engineered nucleases with improved DNA-cleavage specificity. Guilinger JP, Pattanayak V, Reyon D, Tsai SQ, Sander JD, Joung JK, Liu DR. Nat Methods. 2014 Apr;11(4):429-35. doi: 10.1038/nmeth.2845. Epub 2014 Feb 16. 10.1038/nmeth.2845 PubMed 24531420