pDON-AI-Npm2(N533)
(Plasmid
#51475)
-
PurposeExpress mouse phosphorylation-mimicking Npm2 (p-Npm, N533)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDON-AI
-
Backbone manufacturerTAKARA
- Backbone size w/o insert (bp) 5682
- Total vector size (bp) 6354
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNucleoplasmin 2
-
Alt nameNpm2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)622
-
MutationEleven codons (5, 6, 7, 8, 10, 82, 95, 104, 184, 189, and 197) were substituted to Asp.
-
GenBank IDAY262112
-
Entrez GeneNpm2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer cggctattctcgcagctc
- 3′ sequencing primer actttccacacctggttgct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDON-AI-Npm2(N533) was a gift from Shunsuke Ishii (Addgene plasmid # 51475 ; http://n2t.net/addgene:51475 ; RRID:Addgene_51475)