pCDNA6/ERGIC2-WT
(Plasmid
#51479)
-
PurposeExpresses ERGIC2-WT in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDNA6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 6255
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERGIC2-WT
-
Alt namePTX1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1155
-
Mutationnone
-
Entrez GeneERGIC2 (a.k.a. CDA14, Erv41, PTX1, cd002)
- Promoter CMV
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (filled-in) (destroyed during cloning)
- 3′ cloning site XhoI (filled-in) (destroyed during cloning)
- 5′ sequencing primer AATACGACTCACTATAGGGCGA
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA6/ERGIC2-WT was a gift from Simon Kwok (Addgene plasmid # 51479 ; http://n2t.net/addgene:51479 ; RRID:Addgene_51479) -
For your References section:
Molecular cloning, expression, localization, and gene organization of PTX1, a human nuclear protein that is downregulated in prostate cancer. Kwok SC, Liu X, Daskal I. DNA Cell Biol. 2001 Jun;20(6):349-57. 10.1089/10445490152122460 PubMed 11445006