pNJB80
(Plasmid
#51518)
-
Purpose(Empty Backbone) Gateway entry vector with attL5 and attL2 sites flanking a CmR and ccdB gene. In our hands, the multisite reaction still proceeds efficiently.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51518 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR8
- Backbone size (bp) 4000
-
Modifications to backboneAttL1 site was replaced with AttL5 site and Chloramphenicol and ccdB genes were cloned in between the Att sites.
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gaggatccggcttactaaaag
- 3′ sequencing primer agtgatttttttctccatttt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA long oligo containing the attL5 sequence was ordered from Invitrogen. The sequence was fused to the ccdB Chloramphenicol sequence obtained from pFZ19 by PCR amplification.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A single nucleotide from the attL5 sequence is missing (an extra A should be at the 5' end of attL5).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNJB80 was a gift from Daniel Voytas (Addgene plasmid # 51518 ; http://n2t.net/addgene:51518 ; RRID:Addgene_51518) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519