-
PurposeP2A peptide from porcine teschovirus-1 flanked by restriction sites in shuttle vector for easy cloning of multiple separate proteins to be expressed from single message
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepC5-Kan_delta_SphI
-
Backbone manufacturerEF090405
- Backbone size w/o insert (bp) 2619
- Total vector size (bp) 2685
-
Modifications to backboneP2A peptide coding sequence inserted in middle of MCS of pC5-Kan shuttle vector for easy transfer into C5-series Drosophila expression vectors.
-
Vector typeshuttle vector for insect expression vectors
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP2A peptide
-
Alt name2A peptide from porcine teschovirus-1
-
SpeciesSynthetic; porcine teschovirus-1
-
Insert Size (bp)66
-
Mutationcodons altered for Drosophila and to eliminate restriction sites
-
GenBank IDNP_740353
-
Entrez GenePTV1gp1 (a.k.a. PTV1gp1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer AAGCAGCAGATTACGCGCAG
- 3′ sequencing primer GCCATCACGAGATTTCGATTCC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Useful for cloning two proteins for bicistronic expression. Proteins undergo an efficient co-translational separation event due to the presence of the 2A peptide sequence derived from porcine teschovirus-1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC5Kan-P2A was a gift from Barry Ganetzky (Addgene plasmid # 51814 ; http://n2t.net/addgene:51814 ; RRID:Addgene_51814) -
For your References section:
Expression of multiple transgenes from a single construct using viral 2A peptides in Drosophila. Daniels RW, Rossano AJ, Macleod GT, Ganetzky B. PLoS One. 2014 Jun 19;9(6):e100637. doi: 10.1371/journal.pone.0100637. eCollection 2014. 10.1371/journal.pone.0100637 PubMed 24945148