-
PurposeBAC recombineering generated construct, used as a reporter for mouse Oct4 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52382 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBS KS+
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 22128
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameGFP pA
-
SpeciesSynthetic
- Promoter Oct4
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTGTGTGATTCACCCTGGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameOct4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)18000
-
Mutationdeleted -300 - -1300bp fragment upstream from Oct4 ATG
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactataggg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePGK-gb2-Neo
-
SpeciesSynthetic
-
Insert Size (bp)1516
- Promoter PGK+gb2
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGGCTATCAGAGCAGCTTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct is modified pGOF18 from Young Young Il Yeom et al.,Development 122, 000-000 (1996) 881. We have introduced neo selection cassette at the 3' end of the cloned Oct4 locus.
Please note that there are several mismatches in between Addgene's quality control and the depositor's sequence. The mismatches do NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mouse deltaPE Oct4-GFP transgenic reporter was a gift from Jacob Hanna (Addgene plasmid # 52382 ; http://n2t.net/addgene:52382 ; RRID:Addgene_52382) -
For your References section:
Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903