-
Purposeexpresses a myc-tagged version of hCas9 in Drosophila
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52522 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCASPER5
- Backbone size w/o insert (bp) 10877
- Total vector size (bp) 15047
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes cas9 with humanized codon bias
-
Alt namehcas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4170
- Promoter tubulin
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ctcgcacgcagtgccggctcaag
- 3′ sequencing primer TCGAGGTCGACTCTAGATAAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene, vector from mali et al. Science 2013
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB14 was a gift from Klaus Foerstemann (Addgene plasmid # 52522 ; http://n2t.net/addgene:52522 ; RRID:Addgene_52522) -
For your References section:
Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Bottcher R, Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K. Nucleic Acids Res. 2014 Apr 19. 10.1093/nar/gku289 PubMed 24748663