Skip to main content

CMV:: HA-hM4Dnrxn
(Plasmid #52525)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52525 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5029
  • Total vector size (bp) 6664
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-hM4Dnrxn
  • Alt name
    muscarinic receptor 4, axon targeted variant
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1635
  • Entrez Gene
    CHRM4 (a.k.a. HM4, M4R)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer cctcgactgtgccttcta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Bryan Roth, UNC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV:: HA-hM4Dnrxn was a gift from Scott Sternson (Addgene plasmid # 52525 ; http://n2t.net/addgene:52525 ; RRID:Addgene_52525)
  • For your References section:

    Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus-->midbrain pathway for feeding behavior. Stachniak TJ, Ghosh A, Sternson SM. Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24. 10.1016/j.neuron.2014.04.008 PubMed 24768300