Skip to main content
Addgene

pMH5
(Plasmid #52531)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52531 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCASPER2
  • Backbone size w/o insert (bp) 10063
  • Total vector size (bp) 11335
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FLP recombinase
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1272
  • Entrez Gene
    flp
  • Promoter ubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catttgatttcgtactaattttccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMH5 was a gift from Klaus Foerstemann (Addgene plasmid # 52531 ; http://n2t.net/addgene:52531 ; RRID:Addgene_52531)
  • For your References section:

    Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Bottcher R, Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K. Nucleic Acids Res. 2014 Apr 19. 10.1093/nar/gku289 PubMed 24748663